LTS

Bioinformatics workshop 101

McMaster
What is bioinformatics?
The Genetic Code of Life
Try this one ...
What is a phylogenetic tree?
References
Index
Species diversity is important - 2
How to study biodiversity - 3
Exercise
What is bioinformatics?
What do you need to know in bioinformatics?
  1. Computer technology
  2. Biology
  3. Math
  4. All of the above
The Genetic Code of Life

Genetic variation - Changes in the nucleotide sequence of DNA

Genetic
        variation allows us to determine which sequences are more
        related

Each sequence is a different species.

Less change(s) means greater relatedness.

  • There are ___ change(s) between AATG and AAAG
  • There are ___ change(s) between AATG and GGTC
  • There are ___ change(s) between AAAG and GGTC

Figure 1: Changes in the DNA sequence tell us relationships between species.

Try this one ...
Sequence 1
CCTTCAGAATACAGAATAGGGACATAGAGACCCCTTCAGAATACAGAATAGGGACATAGAGACCCCTTCAGAATAGGGACATAGAGACCC
Sequence 2
GGTTCAAAATAGAGAATATGTGACTTTAGAGAGGTTCAAAATAGAGAATATGTGACTTTAGAGAGGTTTATCCCACCCAGCCCCCTGGAC
Sequence 3
TATCCCACCCAGCCCCCTGGACCTGTATCCAATATCCCACCCAGCCCCCTGGACCTGTATCCAATCCACCCAGCCCCCTGGACCTGTATC

Would you do this by hand?

What is a phylogenetic tree?
Divergence of human and ape species

Figure 2: Tree showing the divergence of human and ape species. Approximate dates of divergences are given for, from left to right, orangutan, gorilla, human, bonobo and chimpanzee (Pääbo, 2003)1.


Phylogenetic tree
  • Shows the branching relationships among species
  • Shows common ancestors among species
  • Time goes to the right or up the page
  • Every tree has a root and leaves
Root
'Trunk' of the tree
Leaves
The individuals or species
Ancestor
An individual or species who has one or more descendents
Descendant
An individual or species who comes from an ancestor
Outgroup
  • Outermost individual or species related to the group
  • Give 'direction' to the tree (it is the ancestor of the tree)

References
  1. Pääbo, Svante (2003) The mosaic that is our genome. Nature, 421, 409-412.

Next page - 2